Subject Editor: David C. Lees
The genus
With almost 20,000 described species, the
In 1978 Cees Gielis collected a small unknown female gelechioid moth in Spain, province of Granada. The senior author and Sergey Sinev examined the specimen when preparing the manuscript for the series Microlepidoptera of Europe (
In February 2013 the senior author became aware of new material of this species collected by Peter and Ginny Clarke in Almería, Spain, brought to his attention by Martin Corley. Photos of the female genitalia confirmed that the species was conspecific with the unknown species collected years ago in Granada. More material was gathered in the same locality the following years, and surprisingly turned out to belong to two closely related species.
Although we were convinced that the new species belong to
Since we were unable to match our new species in external morphology or in genitalia to any of the described genera, we describe here the new genus
Genitalia were dissected following the methodology presented by
Photographs of moths were prepared with an AxioCam digital camera attached to a motorized Zeiss SteREO Discovery V12, using the Module Extended Focus in the Carl Zeiss AxioVision software to prepare a picture in full focus from a Z-stack of about 10 to 25 individual photos. Genitalia were photographed with a similar AxioCam camera on a manually operated Zeiss Axioskop H, with just a single exposure.
Morphological terms follow
The distribution map was prepared with DMAP 7.2c (
DNA barcodes were derived from extracts taken from either legs or the abdomen, following the procedures outlined by van
|
|
|
|
|
|
|
|
|
Holotype |
|
LRMNH048-15 | 658 |
|
|
|
|
Paratype |
|
LRMNH014-15 | 658 |
|
|
|
|
Paratype |
|
LRMNH015-15 | 658 |
|
coll. Clarke | |
|
Holotype |
|
LRMNH049-15 | 658 |
|
|
The subfamily is very heterogeneous and members are therefore difficult to distinguish from other families in
Forewing length between ca 3–10 mm. Head smooth, neck tufts slightly raised, ocelli absent, haustellum well developed and scaled. Antenna from three-fourths length to longer than length of forewing, scape often with pecten. Labial palpi rather long and porrect, segment three angled upwards, segment two often shorter than segment two and often rough scaled ventrally, sometimes with protruding bundle longer than segment; maxillary palpi very short.
Forewing and hindwing lanceolate to very lanceolate, most genera with two to ten tufts of raised scales, sometimes with tubercular silvery metallic spots. Forewing with 11 veins, Rs3 and Rs4 stalked, M2, M3, CuA1 and CuA2 often from posterior end of cell and sometimes stalked. Hindwings with 8–10 veins, Sc + R to beyond middle of wing, rarely ending before middle; M1 and M2 stalked. Tibia of midleg apically with one pair of spurs of unequal length, tibia hindleg medially and apically with pair of spurs of unequal length and dorsally with comb of long hairs.
Tergites of abdomen without specialized scales or spines; apodemes tergite I strong and anteriorly widened, semi-circular to straight, apodemes tergite II long and thin, sometimes longer than apodemes of tergite I.
Male genitalia. Uncus present, but often weakly developed and hardly noticeable as small lobe(s); tegumen well-developed, often tapering distally; gnathos as separated pair of arms ending in spherical process with many with rows of spines or peg-like setae or as bundle of teeth; vinculum narrow to rather broad; saccus from small or even absent to very long and rod-shaped; anellus lobes pronounced and often distally dentose; juxta lobes present; valvae large and simple, sometimes small and rounded, weakly sclerotized, occasionally with costal lobe; phallus mainly long, cylindrical and often curved, sometimes short and tapering or distally hooked.
Female genitalia. Apophyses posteriores from almost similar in length to more than ten times as long as apophyses anteriores; sclerotization of tergite VIII can be of diagnostic importance; antrum rather small to very wide, sometimes with sclerotization; ductus bursae long and slender; ductus seminalis attached just anterior of antrum; corpus bursae elongate with a single signum or without signum.
Where known, larvae of
In the 19th and in most of the 20th century the species, now in
The name
In North America
Hodges’ concept of
There were two notable exceptions:
However, in Australia,
Up to the end of the 20th century, the classifications were still based on classical taxonomic authority, giving diagnostic characters, which may be sometimes termed as apomorphies, but without modern phylogenetic analyses. This changed when
A more extensive cladistic analysis, still based on morphology alone, was published by
The recent
That changed in the first molecular phylogeny of
In an elegant combined analysis of morphological and molecular characters,
Whereas these phylogenetic studies only comprise a subset of genera, more detailed taxonomic studies have in recent years added information on the composition of the subfamily, and on the basis of these works together (
The narrow forewings, the long, slender and curved gnathos arms with a pecten in the male genitalia, in combination with the wide antrum and the irregular row of spicules in the ductus bursae in the female genitalia are characteristic for
The morphology of the male genitalia differs from all other known
Currently only known from the two new species, found in a small area of Mediterranean Spain, provinces of Almería and Granada.
The generic name
Male (Fig.
Female (Figs
Measurements: Length from vinculum to uncus 460 μm, width 435 μm, valva length 560 μm, width 200 μm, phallus length (measured in straight line) 765 μm; longest cornutus 110 μm.
(Fig.
Host-plants and early stages are unknown. The adults have been collected at light from the end of January till late April. The specimen from Granada was collected on a dry northern slope of a hill at an elevation of approximately 700 m. The vegetation consisted, among other things, of small shrubs and herbs belonging to
We barcoded three specimens, including the holotype, resulting in three identical barcodes, with BIN
The barcode reads:
aactttatattttatttttggaatttgagcaggaatagtaggaacatcacttagtttattaattcgagctgaattaggaaccccaggctctttgattggagatgaccaaatttataatactattgtcacagctcatgcttttattataattttttttatagtaatacctattataattggaggatttggtaactgattagttcctttaatattaggagcccctgatatagcattccctcgaataaacaatataagtttctgacttttacccccttctattactcttctaatttcaagtagtattgtagaaaatggagctggaacaggatgaacggtttacccccccctttcatctaatattgctcatagaggtagatcagttgatttagcaatcttttctcttcatttagctggaatttcttctattttaggagctattaattttatcacaactattattaatatacgtctaataaatatatcttttgatcaaatacctttatttgtttgagcagttggaattacagctttacttctgcttctttctttacctgttttagctggagctattactatgttattaacagatcgtaatctaaatacttcattttttgaccctgctggtggaggagacccaattctttatcaacatttattt
The specific epithet
The forewing of the male holotype is darker than in all females examined, and the pattern elements are more or less fused. Whether this constitutes sexual dimorphism or simple variation can only be decided after collecting more males. We decided to select the male as holotype, since the male genitalia provide the best characters, and only males are known of the next species
Type locality of both
Measurements: Length from vinculum to uncus 590 μm, valva length 525 μm, phallus length (measured in straight line) 655 μm; longest cornutus 125 μm.
(Fig.
Host-plants and early stages are unknown. The specimens were collected at light in the same locality as
We barcoded the holotype, with BIN
The barcode reads:
aactttatattttatttttggaatttgagcaggaatagtaggtacatctcttagtttattaattcgagctgaactaggaacccccggatctttaattggtgatgatcaaatttataatactattgttacagctcacgcttttattataattttttttatagttatacctattataattggaggatttggaaattgattagttcctttaatattaggagccccagatatagctttcccccgaataaataatataagtttttgattattacctccttctcttacccttttaatttcaagtagtattgtagaaaatggagctgggacaggatgaacggtttacccccccctttcatctaatatcgctcatagaggtagatcagtagatttagcaattttttcccttcatttagctggaatttcttcaattttaggagctattaattttattacaactattattaatatacgattaataaatatatcttttgatcaaatacccctatttgtttgagcagttgggatcacagctcttcttcttcttctttccttacctgttttagctggagctattactatattattaacagatcgtaatttaaatacctcattttttgatcctgctggtggaggagaccctattttataccaacatttattt
The epitheton
The new species cannot confidentially be placed in any of the European genera of
Considering the very rich Parametriotine fauna of Australia, and the fact that several Australian trees are frequently planted in Spain (eucalypts, wattles), also close to the type locality, made us consider the possibility of an introduction of an Australian insect. Checking the DNA barcodes of both species in the
We strongly urge that diverse groups with important life histories, such as these Australian
Neighbor Joining tree of DNA barcodes of
We like to express our appreciation to Cees Gielis (Lexmond, The Netherlands) for his co-operation and to Pete and Ginny Clarke (Glasbury on Wye, United Kingdom/Enix, Spain) for the loan and donation of material from Almería. We also thank Martin Corley (Faringdon, United Kingdom) who brought the material of the Clarke collection under our attention. Camiel Doorenweerd (Naturalis Biodiversity Center, Leiden, The Netherlands) is acknowledged for analysing the DNA barcodes. Ted Edwards (
Our sincere thanks also go to John Langmaid for linguistic corrections of an earlier version of the manuscript. Marieta Sanjuan Martinez is acknowledged for the photographs of the collecting site in Almería.
Note: references to authorities of taxon names are given at the end of the appendix.
All genera we believe belong to
On a second line we provide respectively the type species, original family assignments and later placements. Synonyms are indented.
In order to show some of the diversity we publish here a few water colours and drawings of Eastern Asian and African species, prepared by the senior author, that had not been published before (Figs
Type genus
Type genus
Type genus
Type species
Type species
Type species
Type species
Type species
Type species
Type species
Type species
Type species
Type species
Type species
Type species
Type species
Type species
Type species
Type species
Type species
Type species
Type species
Type species
Type species
Type species
Type species
Type species
Type species
Type species
Type species
Type species
Type species
Type species
Type species
Type species
Type species
Type species
Type species
Type species
Type species
Type species
Type species
Described in
Type species
Type species
Type species
Described in
Type species
Type species
Type species
An objective replacement name for
Type species
Type species
Type species
Type species
Type species
The genus belongs to
Type species
Type species
Type species
Type species
Meyrick described this genus from Australia with 22 species. An additional 20 species were added by later authors. The genus shows external similarity with
Type species
The genus has been described from Mexico.
Type species
Type species
Type species
The genus had already been removed from
Only two species were left in
Type species
Examples of adult
Undescribed species of
Agassiz L (1847) Nomenclatoris zoologici index universalis. Sumptibus Jent et Gassma, Soloduri, 1135 pp.
Agassiz L, Desor E (1847) Catalogue raisonné des espèces, des genres et des familles d’Échinides. Annales des Sciences naturelles Paris, Série 3, Zoologie 7: 129–168.
Amsel HG (1968) Zur Kenntnis der Microlepidopterenfauna von Karachi (Pakistan). Stuttgarter Beiträge zur Naturkunde 191: 1–48.
Baldizzone G (1979) Les types d’E Meyrick conservés au Muséum National d’Histoire Naturelle de Paris. Alexanor 11: 167–170.
Baldizzone G (1989) Contribuzioni alla conoscenza dei
Becker VO (1984a) The Neotropical
Becker VO (1984b)
Becker VO (1999) Family reassignments and synonymy of some taxa of Neotropical Microlepidoptera. Revista Brasileira de Zoologia 16: 141–170.
Billberg GJ (1820) Enumeratio Insectorum. Typis Gadelianis, [Stockholm], 138 pp.
Bottimer LJ (1926) Notes on some
Braun AF (1919) Notes on
Bruand MT (1850) Catalogue systématique et synonymique des Lépidoptères de département du Doubs. Tinéides. Mémoires de la Société d’émulation du Doubs (1) 3(1): 23–68.
Busck A (1912) Descriptions of new genera and species of Microlepidoptera from Panama. Smithsonian Miscellaneous Collections 59(4): 1–10.
Căpuşe I (1971) Récherches morphologiques et systématiques sur la famille des
Chambers VT (1880) Descriptions of some
Clarke JFG (1962) Neotropical Microlepidoptera. I. The genus
Clarke JFG (1964) A new genus and species from the Juan Fernandez Islands (
Clarke JFG (1965) Catalogue of the type specimens of Microlepidoptera in the British Museum (Natural History) described by Edward Meyrick. Volume V. Trustees of the British Museum, London, 581 pp.
Clerck C (1759) Icones Insectorum rariorum, cum nominibus eorum trivialibus, locisque e C. Linnaei. Holmiae, xii+iii. [55 pls]
Curtis J (1827) British Entomology, 4. Nos 147–194, pls 147–194. London.
Denis I, Schiffermüller I (1775) Ankündung eines systematischen Werkes von den Schmetterlingen der Wienergegend. Augustin Bernardi Buchhändler, Wien, 323 pp.
Diakonoff A (1955) Microlepidoptera of New Guinea. Results of the Third Archbold Expedition (American-Netherlands Indian Expedition 1938–1939). Part V. Verhandelingen der Koninklijke Nederlandsche Akademie van Wetenschappen, Amsterdam, Afdeling Natuurkunde (2e reeks)50: 1–212.
Dugdale JS (1988)
Duponchel PAJ 1838-[1840] Nocturnes 8. In Godart JB (Ed.) Histoire naturelle des Lépidoptères ou papillons de France 11. Méquignon-Marvis, Paris, 720 pp. [pls. 287–314]
Fletcher TB (1928)
Fletcher TB (1929) A list of the generic names used for Microlepidoptera. Memoirs of the Department of Agriculture in India, Entomological Series 11: 1–244.
Forbes WTM (1931) Supplementary report on the
Heikkilä M, Mutanen M, Kekkonen M, Kaila L (2014) Morphology reinforces proposed molecular phylogenetic affinities: a revised classification for
Heikkilä M, Mutanen M, Wahlber, N, Sihvonen, P, Kaila L (2015) Elusive ditrysian phylogeny: an account of combining systematized morphology with molecular data (
Heinemann H, Wocke MF ([1876] 1877) Die Schmetterlinge Deutschlands und der Schweiz. Zweite Abtheilung. Kleinschmetterlinge. Band 2. Die Motten und Federmotten. Heft 2. C. A. Schwetke und Sohn, Braunschweig: 389–825, v-vi, Tabelle 1–102.
Heppner JB (1981) A world catalog of genera associated with the
Herrich-Schäffer GAW (1853–1855) Systematische Bearbeitung der Schmetterlinge von Europa 5. Die Schaben und Federmotten. G. J. Manz, Regensburg, 394 pp.
Hodges RW (1962) A revision of the
Hodges RW (1978)
Hodges RW (1997) A new agonoxenine moth damaging
Hofmann O (1898) Drei neue Tineen-Gattungen. Deutsche Entomologische Zeitschrift Iris 10(1897)(2): 225–230.
Hübner J (1796-[1836]) Sammlung europäischer Schmetterlinge 8: Tineae-Schaben, Augsburg, 78 pp. [71 pls]
Hübner J (1816-[25]) Verzeichniss bekannter Schmetterlinge. Augsburg, 431 pp.
International Commission on Zoological Nomenclature (1986) Opinion 1418:
Janse AJT (1917) Check-list of the South African
Kaila L, Mutanen M, Nyman T (2011) Phylogeny of the mega-diverse
Kameda M (1988)
Kasy F (1976) Über die Familienzugehörigkeit einiger “
Kasy F (1969) Einige Richtigstellungen und Bemerkungen zu Amsel, 1968: Zur Kenntnis der Microlepidopterenfauna von Karachi (Pakistan). Zeitschrift der Arbeitgemeinschaft österreichen Entomologen 4: 87–98.
Kusnezov NJ (1916) Description of
Lacépède BGÉ de (1802) Histoire naturelle des poissons 4, Plasson, Paris, 728 pp.
Leraut P (1980) Liste systématique et synonymique des Lépidoptères de France, Belgique et Corse. Alexanor, Supplement, 334 pp.
Lower OB (1893) New Australian
Lvovsky AL (1996) A review of the genus
Meyrick E (1889) Descriptions of New Zealand Micro-
Meyrick E (1897) Descriptions of Australian Micro-
Meyrick E (1908) Descriptions of African Micro-
Meyrick E (1911) Descriptions of South African Micro-
Meyrick E (1913a) Descriptions of South African Micro-
Meyrick E (1913b) Exotic Microlepidoptera 1(3): 65–96.
Meyrick E (1914a) Exotic Microlepidoptera 1(7): 193–224.
Meyrick E (1914b)
Meyrick E (1914c) Descriptions of South African Micro-
Meyrick E (1914d)
Meyrick E (1915) Exotic Microlepidoptera 1(11): 321–352.
Meyrick E (1916a) Exotic Microlepidoptera 1(18): 545–576.
Meyrick E (1916b) Descriptions of New Zealand
Meyrick E (1917) Exotic Microlepidoptera 2(3): 65–96.
Meyrick E (1921) Exotic Microlepidoptera 2(13): 385–416.
Meyrick E (1922) Exotic Microlepidoptera 2(18): 545–576.
Meyrick E (1924) Exotic Microlepidoptera 3(3): 65–96.
Meyrick E (1928) Exotic Microlepidoptera 3(13): 385–416.
Meyrick E (1929) The Micro-
Meyrick E (1930) Ergebnisse einer zoologischen Sammelreise nach Brasilien, insbesondere in das Amazonasgebiet, ausgeführt von Dr. H. Zerny. V. Teil Micro-
Meyrick E (1931) Exotic Microlepidoptera 4(6): 161–192.
Meyrick E (1932) Exotic Microlepidoptera 4(10): 289–320.
Meyrick E (1935a) Exotic Microlepidoptera 4(18): 545–576.
Meyrick E (1935b) Exotic Microlepidoptera 4(19): 577–608.
Meyrick E (1936) Exotic Microlepidoptera 4(20): 609–642.
Meyrick E (1937) Exotic Microlepidoptera 5(3): 65–96.
Minet J (1986) Ébauche d’une classification moderne de l’ordre des Lépidoptères. Alexanor 14 (7): 291–313.
Nielsen ES (1996)
Nye IWB, Fletcher DS (1991) Microlepidoptera. The generic names of moths of the world 6. British Museum (Natural History), London, 368 pp.
Park KT (1986) A larval gall-making species of the genus
Rebel H (1902) Lepidopteren aus Morea, gesammelt von Herrn Martin Holz im Jahre 1901. Berliner Entomologischer Zeitschrift 47(1–2): 83–110.
Riedl T (1994) Liste des taxa de six familles des Lépidoptères
Sinev SY (1979) The species and systematic position of the genus
Sinev SY (1982) Specific composition and systematic position of the genus
Sinev SY (1988) New taxa of the
Sinev SY (1992) On the system and phylogeny of the
Sinev SY (1999) Notes on the synonymy of the narrow-winged moths (
Sinev SY (2002) World catalogue of cosmopterigid moths (
Sinev SY (2004)
Spuler A, Meess A (1910) Fam.
Stainton HT (1849) An attempt at a systematic catalogue of the British
Stainton HT (1854)
Vári L, Kroon D, Krüger M (2002) Classification and checklist of the species of
Viette P (1958) Nouveaux Microlépidoptères du massif de l’Ankaratra (Madagascar centre) (Lep.,
Walker F (1864) List of the specimens of lepidopterous insects in the collection of the British Museum. Part 30. Tineites. London, 837–1096.
Walker F (1866) List of the specimens of lepidopterous insects in the collection of the British Museum. Part 35.
Walsingham T de Grey (1881) On the
Walsingham T de Grey (1891) African Micro-
Walsingham T de Grey (1909)
Yang CK (1977) Moths of North China. Vol. I. Beijing, 299 pp. [12 pls]
Zeller PC (1863) Zwölf amerikanische Nachtfalter. Stettiner Entomologische Zeitung 24: 136–155.