Research Article
Print
Research Article
A new species of Homalernis Meyrick, 1908 (Lepidoptera, Tortricidae, Tortricinae) represents the first record of the tribe Schoenotenini in Japan
expand article infoShinya Suzuki‡, Utsugi Jinbo§, Sadahisa Yagi‡, Toshiya Hirowatari‡
‡ Kyushu University, Fukuoka, Japan
§ National Museum of Nature and Science, Tsukuba, Japan

Corresponding author: Shinya Suzuki ( ftrjy134@yahoo.co.jp )

Academic editor: Erik J. van Nieukerken
© 2024 Shinya Suzuki, Utsugi Jinbo, Sadahisa Yagi, Toshiya Hirowatari.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Suzuki S, Jinbo U, Yagi S, Hirowatari T (2024) A new species of Homalernis Meyrick, 1908 (Lepidoptera, Tortricidae, Tortricinae) represents the first record of the tribe Schoenotenini in Japan. Nota Lepidopterologica 47: 113-123. https://doi.org/10.3897/nl.47.120384
ZooBank: urn:lsid:zoobank.org:pub:4F1F87DF-D514-451B-9FC8-028C2B49B11D
Open Access

Abstract

Homalernis fluctuosa Suzuki & Jinbo, sp. nov., is described and illustrated from Honshu, Shikoku, Kyushu, Tsushima Island, Amamiooshima Island, and Okinawajima Island, Japan. This is not only the first record of the genus Homalernis but also of the tribe Schoenotenini from warm temperate zones in the Palaearctic region. The association of males and females of the new species was confirmed based on the mitochondrial gene cytochrome oxidase submit 1 (COI). We discuss the taxonomic positions of two alleged Homalernis species from Malaysia and the taxonomic position of Homalernis within Schoenotenini.

Introduction

The tribe Schoenotenini (Tortricidae: Tortricinae) consists of 34 genera and 233 species from the Oriental and Australian regions (Razowski 2008; Gilligan et al. 2018; Groenen 2022). The tribe was first established by Diakonoff (1952) as the monobasic family Schoenotenidae, based on Schoenotenes Meyrick, 1908 (type-species: S. synchorda Meyrick, 1908). Subsequently, Schoenoteninae were treated as a subfamily of the Tortricidae (Common 1958) or a tribe of the Chlidanotinae (Diakonoff 1960). Common (1965) confirmed that the former is the more appropriate placement for this taxon, and currently, Schoenotenini are regarded as a tribe of Tortricinae (e. g. Horak 1998; Razowski 2008; Gilligan et al. 2018).

Morphologically, Schoenotenini are considered a monophyletic group based on the following forewing characteristics: an M-stem vein that terminates between M1 and M2, an almost equal arrangement of radial veins, and often with raised scales (Common 1965; Dugdale 1966; Horak 1998; Razowski 2008). In a molecular phylogenetic analysis of the Tortricidae, Schoenotenini were placed as a clade with Epitymbiini + Archipini or Phricanthini; however, neither hypothesis was well supported (Fagua et al. 2017).

Meyrick (1908) described Homalernis semaphora Meyrick, 1908 from Assam (India), designating it as the type species of his new genus, which he assigned to Tortricinae. A decade later, Meyrick (1918) described a second species of the genus, H. arystis, also from Assam (India). Diakonoff (1939) initially placed Homalernis in the family Eucosmidae (currently regarded as Eucosmini of Olethreutinae). Subsequently, Diakonoff (1960) included the genus in the Schoenotenini without discussion, but he mentioned that the female genitalia closely resembled those of Metachorista, another member of this tribe. Common (1965) included Homalernis in Schoenotenini, remarking that it was closely related to the Proselena group of genera based on similarities of the female genitalia.

Currently, there are four described species assigned to Homalernis: H. arystis Meyrick, 1918, H. jeriau Razowski, 2012, H. mankoboi Razowski, 2012, and H. semaphora Meyrick, 1908 (Gilligan et al. 2018). The type species of this genus, H. semaphora, was described allegedly based on a single male and a single female; however, Diakonoff (1939) found that the specimen reported as male was a female. Meyrick (1918) also described H. arystis based on a female specimen. In contrast, Razowski (2012) described both H. jeriau and H. mankoboi based on single males each and placed these two species in Homalernis based on similarities in appearance and wing venation. Therefore, no species in this genus has been described from both sexes, and the placement of the two species described based on only males needs confirmation.

While examining Tortricidae collected in Japan, we found many unidentified specimens of Homalernis. Based on morphological examination, we concluded that this was an undescribed species. In this study, we describe this species as new; it represents the first record of the tribe Schoenotenini and the genus Homalernis from Japan as well as from the Palaearctic region. In addition, we discuss the validity of the species assigned to the genus Homalernis.

Materials and methods

Sampling and dissection

We examined specimens deposited in the following institutions:

CBM Natural History Museum and Institute, Chiba. Chiba, Chiba Prefecture, Japan.

NSMT National Museum of Nature and Science. Tsukuba, Ibaraki Prefecture, Japan.

ELKU Entomological Laboratory, Kyushu University. Fukuoka, Fukuoka Prefecture, Japan.

Images of adults were obtained using a SONY α7R IV digital camera fitted with a CANON MP-E 65 mm macro lens. To examine the male and female genitalia, the abdomens of the specimens were removed and boiled in a 10% KOH solution for approximately 10 min. After washing with 70% ethanol, the genitalia were dissected in 70% ethanol, stained with Chlorazol Black E solution, and mounted in Euparal on glass slides. The specimens were dissected and examined under a Nikon SMZ1000 binocular microscope. Images of the genitalia were obtained using a CANON 90D digital camera attached to a Nikon ECLIPSE Ci stereoscopic microscope and processed using Adobe Photoshop 2023 and Illustrator 2023 software. To examine wing veins, wings were removed, descaled using tissue papers and tweezers, stained with acetocarmine solution for 24 h, and mounted in Euparal on glass slides. Wing veins were drawn with Adobe Illustrator 2023 based on the images obtained using a CANON 90D digital camera connected to a Nikon ECLIPSE Ci stereoscopic microscope.

Terminology

The terminology used is primarily that of Razowski (2008). Additional terms related to the male genitalia are shown in Fig. 2D.

DNA extraction, PCR amplification, and sequencing

Six adult specimens of Homalernis fluctuosa Suzuki and Jinbo, sp. nov. were selected for DNA analysis (Table 1). DNA was extracted from the abdomen of each moth using a DNeasy Blood and Tissue Kit (Qiagen, Netherlands), following the manufacturer’s protocol.

Table 1.
Download as
CSV
XLSX

Sample information of Homalernis fluctuosa used for DNA analyses.

Location Collection date BOLD BIN# GenBank accession number #bp Sex
Hiroshima Pref., Akioota-Chou, Yokogou 12. vi. 2022 AFM6059 PP131391 658 Male
Hiroshima Pref., Akioota-Chou, Yokogou 12. vi. 2022 AFM6059 PP131390 658 Female
Fukuoka Pref., Umi-Machi, Yakikomegahara 15. v. 2022 AFM6059 PP131389 658 Female
Fukuoka Pref., Fukuoka-Shi, Sawara ku Mt. Sefurisan 14. v. 2021 AFM6059 PP131388 658 Female
Nagasaki Pref., Tsushima-Shi, Izuharamachi, Kamizaka Park 6. vi. 2021 AFM6059 PP131387 658 Female
Okinawa Pref., Higashi-Son., Takae 7. x. 2021 AFM6059 PP131386 658 Female

To obtain partial sequences of the mitochondrial cytochrome oxidase subunit 1 (COI) gene (standard DNA barcode region), the sequences were amplified using the primers LCO1490 (GGTCAACAAATCATAAAGATATTGG) and HCO2198 (TAAACTTCAGGGTGACCAAAAAATCA) (Folmer et al. 1994). The PCR reaction mixture consisted of 5 µL of KOD One® PCR Master Mix -Blue- (TOYOBO, Japan), 0.3 µL (10 pmol/µL) of each of the forward and reverse primers, and 1.0 µL of template DNA, with Milli-Q water added to a final volume of 10 µL. PCR amplification was performed as follows: an initial denaturing at 98 °C for 10 s, followed by 35 cycles at 98 °C for 10 s, 50 °C for 5 s, and 68 °C for 5 s. The amplified products were purified using ExoSAP-IT™ Express (Thermo Fisher Scientific Inc., USA) and sequenced using Pre-mixed Sanger sequencing services (Azenta, USA).

Pairwise distances based on the K2P method were calculated using MEGA X software (Kumar et al. 2018) to quantify the genetic distance between males and females and intraspecific variation.

Results

Taxonomy

Homalernis Meyrick, 1908

Homalernis Meyrick, 1908: 620. Type species: Homalernis semaphora Meyrick, 1908, by monotypy.

Diagnosis

Homalernis is characterised by the following features: hindwing veins Rs and M1 widely separate, M3 and CuA1 short stalked at the base (Fig. 4B); male genitalia with a deeply bifid uncus and a valva with both the costa and sacculus extended into projections (Fig. 2A, C) and female genitalia with a pair of wedge-shaped signa in the corpus bursae (Fig. 3A, B).

Homalernis is similar to Diactenis Meyrick, 1907 in wing venation with all veins free in the forewing, the M-stem well-developed; and the hindwing with a very slender median cell (Fig. 4A). The two genera also share a bifid uncus in the male genitalia. The female genitalia of Diactenis are easily distinguished by the absence of a distinct signum in the corpus bursae. The female genitalia of Homalernis shares with Syncratus Common, 1965 a twisted ductus bursae and a pair of similar signa, although the signum is a round plate with a blade-like process in Syncratus. Metachorista Meyrick, 1938 shares with Homalernis a valva with the costa and sacculus ending in distal projections in the male genitalia; and a similar shaped signum in the female genitalia, However, Metachorista has a hindwing with Rs and M1 stalked; prominent hami in the male genitalia; and only a single signum in the female genitalia.

Redescription

Adult (Fig. 1). Head coarsely and densely covered with scales. Parietal portion to frons densely covered with thick scales. Antennae approximately 1/2 length of forewing, with short sensory setae, scape basally covered with scales covering frons. Labial palpus approximately 1.5 times length of eye diameter, second palpomere broadening towards tip, apex covered with coarse hair-like scales. Forewing costa slightly curved basally, slightly concave medially and gently curved toward apex, apex roundish pointed and projected, termen strongly oblique, lightly curved, dorsum straight, except for curved basal part; patches of raised scales tufts at end of cell. Hindwing: slender and long, rather sparsely scaled except along veins, especially on underside, approximately 3 times as long as wide; costa curved basally, slightly concave medially, and straight and slightly oblique in outer half, apex rounded, termen rather straight and oblique below apex, dorsum rounded.

Figure 1. 

Homalernis fluctuosa, sp. nov. A. Holotype, male; B. Paratype, female (Fukuoka Prefecture, Soeda-machi, Mt Hikosan). DB – dorsal blotch; MF – median fascia, STF – subterminal fascia; SAF – subapical fascia; PAF – preapical facia. Scale bars: 5 mm.

Figure 2. 

Male genitalia of Homalernis fluctuosa, sp. nov. A. Holotype, genitalia slide no. Shinya Suzuki 2022-80; B. Phallus of holotype, genitalia slide No. Shinya Suzuki 2022-80; C. Paratype (Chiba Prefecture, Kimitsu-shi, Okisawa, Goudai Camp), genitalia slide No. Shinya Suzuki 2022-129; D. Phallus of paratype (Chiba Prefecture, Kimitsu-shi, Okisawa, Goudai Camp), genitalia slide No. Shinya Suzuki 2022-129; E. Gnathos of holotype, genitalia slide No. Shinya Suzuki 2022-80; F. Juxta of holotype, genitalia slide No. Shinya Suzuki 2022-80. DP – dorsoposterior projection; SP – saccular projection. Scale bars: 0.5 mm (A–D); 0.1 mm (E, F).

Figure 3. 

Female genitalia of Homalernis fluctuosa, sp. nov. A. Paratype (Mie Prefecture, Matsusaka-shi, Iitakachou, Haze), genitalia slide No. Shinya Suzuki 2022-130; B. Signum of paratype (Fukuoka Pref., Soeda-machi, Mt. Hikosan), genitalia slide No. SY1595. Scale bars: 0.5 mm (A); 0.1 mm (B).

Figure 4. 

Venation of Homalernis fluctuosa, sp. nov. A. Forewing; B. Hindwing. Scale bars: 0.5 mm.

Venation (Fig. 4): Forewing: discal cell approximately 3/5 length of forewing, narrow at base and widening distally, slightly curved to dorsum, all veins separate except distal half of 1A+2A, R1 to R4, R5 to M2 nearly equidistant; M3 and CuA1 slightly curved basally, CuA1 from angle of cell, CuA2 from 3/5 of cell, 1A+2A with basal fork. Hindwing: cell approximately 2/5 length of hindwing, slender and elongated, slightly broadened from base to middle, apical half tapering distally; Rs and M1 separate and remote at base, M1 to M3 equidistant, M3 and CuA1 stalked at base, from apex of cell, CuA2 from distal 1/8 of cell, slightly sinuate to termen.

Male genitalia (Fig. 2A–F): Uncus long and narrow, bifurcated apically and slightly fused basally. Hami absent. Socius somewhat slender and long, hairy. Gnathos sclerotised, lateral parts broad, with five raised and pointed spines with non-bifurcated apices. Valva membranous; costa strongly sclerotised, dorsoposterior projection elongated to approximately 0.5 times length of valva, with dense and strong setae; sacculus sclerotised, saccular projection elongated to approximately 0.3 times length of distal edge of valva, sparsely covered with fine hairs. Transtilla slightly thick, concave dorsomedially. Vinculum ending in sharp point. Phallus slender and tubular, cornuti several tiny thorns.

Female genitalia (Fig. 3A, B): Papilla analis long and slender. Apophysis posterioris and apophysis anterioris short, approximately 1.6–1.8 times longer than Papilla analis. Ductus bursae very long and narrow, posterior 1/3 straight, anterior 2/3 twisted, with a slightly sclerotised ring near ductus seminalis. Corpus bursae ovate and large, with a pair of signa, basal round plates with a flatten blade-shaped projection inwardly.

Distribution

India, Japan (new record), ?Malaysia.

Homalernis fluctuosa Suzuki & Jinbo, sp. nov.

https://zoobank.org/F7AA82A5-F254-49A6-98F5-8CC9D37BC8D2
Japanese name: Sazanami-tatege-hamaki

Type material

Holotype Japan • ♂; Honshu, Hiroshima Pref., Akioota-chou, Yokogou; alt. 989 m; 34.5968°N, 132.1773°E; 12. vi. 2022; S. Yagi leg.; genitalia slide No. Shinya Suzuki 2022-80; ELKU.

Paratypes Japan • Honshu: 1♂4♀; Chiba Pref., Kimitsu-shi, Kiwadabata, Fudagou Camp; 10. x. 2012; O. Saito leg.; CBM • 2♀; Chiba Pref., Kimitsu-shi, Kiwadabata, Fudagou Camp; 5. vi. 2013; O. Saito leg.; CBM • 1♀; 25. ix. 2013; same locality and collector; CBM •1♂; 6. vi. 2015; same locality and collector; CBM • 1♀; Chiba Pref., Kimitsu-shi, Orikisawa, Ainosawa; 25. vi. 2014; O. Saito leg.; CBM • 1♂1♀; Chiba Pref., Kimitsu-shi, Okisawa, Goudai Camp; 2. x. 2013; O. Saito leg.; genitalia slide No. Shinya Suzuki 2022-129; CBM • 4♀; Ishikawa Pref., Shika-machi, Kyuubun; 29. v. 2016; A. Tomisawa leg.; ELKU • 1♀; Gifu Pref., Toki-shi, Izumichou, Ootomi; alt. 280 m; 6. vi. 2010; A. Miyano leg.; ELKU • 1♀; Shizuoka Pref., Nakakawane-chou, Orokubo; 17. vi. 1995; U. Jinbo leg.; NSMT • 1♂1♀; Aichi Pref., Shinshiro-shi, Tsugeno; 12. vi. 1988; T. Mano leg.; ELKU • 1♂; Aichi Pref., Shitara-chou, Kada, Hotokezaka pass; 15. vi. 1991; T. Mano leg.; ELKU • 1♂; Aichi Pref., Toyokawa-shi, Zaizenji temple; 4. vi. 1994; T. Mano leg.; ELKU • 1♀; Aichi Pref., Otowa-chou, Nagasawa; alt. 120 m; 28. v. 2001; T. Mano leg.; ELKU • 8♀; Aichi Pref., Toyota-shi, Nishihirose; 8. vi. 1996; T. Mano leg.; ELKU • 2♀; Mie Pref., Inabe-chou, Ichinohara; 1. vi. 1986; T. Mano leg.; ELKU • 1♀; Mie Pref., Seki-machi, Washiyama; 11. vi. 1991; T. Mano leg.; ELKU • 1♀; Mie Pref., Matsusaka-shi, Iitakachou, Haze; 4. vi. 2022; H. Arashima leg.; genitalia slide No. Shinya Suzuki 2022-130; ELKU • 1♀; Mie Pref., Misugi-mura, Hirakura; 8. vi. 1991; T. Mano leg.; ELKU • 2♀; Mie Pref., Ueno-shi, Otoki pass; 15. vi. 1996; T. Mano leg.; ELKU • 1♀; Mie Pref., Ueno-shi, Araki; alt. 220 m; 14. v. 1998; T. Mano leg.; ELKU • 1♀; Mie Pref., Ueno-shi, Hijiki; alt. 340 m; 23. v. 1997; T. Mano leg.; ELKU • 1♀; Mie Pref., Hokusei-machi, Obaraishiki, Oozo; alt. 560 m; 12. vi. 1997; T. Mano leg.; ELKU • 1♀; Mie Pref., Miyagawa-mura, Oodaigahara; 23. vi. 2007; T. Mano leg.; ELKU • 1♀; Tottori Pref., Tottori-shi, Oochidani Park; alt. 40 m; 35.4996°N, 134.2448°E; 7. vi. 2014; Y. Matsui leg.; ELKU • 1♀; Tottori Pref., Tottori-shi, Sourokubara; alt. 40 m; 35.4544°N, 134.1059°E; 17. v. 2020; Y. Matsui leg.; ELKU • 2♀; same label as holotype; genitalia slide No. Shinya Suzuki 2022-80; ELKU.

Shikoku: 1♀; Kohchi Pref., Ochi-chou, Mt. Yokokurayama; 31. v. 2013; Y. Manabe leg.; ELKU.

Kyushu: 1♀; Fukuoka Pref., Kitakyushu-shi, Yahata, Orio; 13. v. 1962; T. Kawamura leg.; ELKU • 1♀; Fukuoka Pref., Soeda-machi, Mt. Hikosan; 18. vi. 1962; H. Kuroko leg.; ELKU • 1♀; Fukuoka Pref., Soeda-machi, Mt. Hikosan; alt. 679 m; 33.4823°N, 130.9090°E; 29. v. 2014; S. Yagi leg., genitalia slide No. SY1595; ELKU • 1♀; same locality and collector; 5. vi. 2014; ELKU • 1♀; same locality; 20. vi. 2020; S. Tomura leg.; ELKU • 1♀; same locality and collector; 12. vi. 2021; ELKU • 1♀; same locality; 12. vi. 2021; K. Sasaki leg.; ELKU • 1♀; same locality; 19–20. v. 2023; K. Eda, K. Yazaki, T. Akiba, K. Suzuki, K. Sasaki, T. Fukuzono, I. Kawashima, J. H. Park leg.; ELKU • 1♀; Fukuoka Pref., Umi-machi, Yakikomegahara; alt. 340 m; 33.5320°N, 130.5229°E; 15. v. 2022; S. Tomura leg.; ELKU • 1♀; Fukuoka Pref., Fukuoka-shi, Sawara ku Mt. Sefurisan; alt. 980 m; 33.4341°N, 130.3665°E; 14. v. 2021; S. Tomura leg.; ELKU.

Tsushima Island: 2♀; Nagasaki Pref., Tsushima-shi, Izuharamachi, Kamizaka Park; 34.2422°N, 129.2857°E; alt. 385m; 6. vi. 2021; S. Tomura leg.; ELKU.

Yakushima Island: 3♀; Kagoshima Pref., Yakushima-shi, Nakama, Koyouji; 30.2896°N, 130. 4767°E; 20. v. 2023; F. Ishiwata leg.; ELKU.

Amamiooshima Island: 1♀; Kagoshima Pref., Sumiyou-chou, Santarou pass; 12. vii. 2010; T. Mano leg.; ELKU.

Okinawajima Island: 1♀; Okinawa Pref., Kunigami-son, Ada; alt. 295 m; 21. vi. 2022; Y. Uehara and S. Yoshioka leg.; ELKU • 1♀; Okinawa Pref., Higashi-son, Takae; alt. 237 m; 26.7016°N, 128.2424°E; 7. x. 2021; M. Kimura leg.; ELKU.

Diagnosis

Homalernis fluctuosa, sp. nov., is most similar to H. arystis in characteristics of the forewings and female genitalia. The two species can be distinguished based on the following: in H. fluctuosa, the apical third of the forewing has three distinct narrow fasciae, and the hindwing is approximately 3/4 the length of the forewing, whereas in H. arystis, the apical third of the forewings has scattered dark scales and the hindwing is approximately 2/3 the length of the forewing. In addition, the pair of signa of the female genitalia of H. fluctuosa is narrower and less sclerotised than those in H. arystis.

Description

Adult (Fig. 1). Head: Vertex and frons white. Antenna white. Length of labial palpus approximately 1.5 times eye diameter, white on outer surface, brownish ochre on inner surface.

Thorax: Dorsum brownish white; tegula white. Forewing length 6 mm in holotype, 4–7 mm in paratypes (n = 62). Forewing; ground colour greyish white, with scattered pale brown scales, small dark brown spots along wing margin; blackish-brown dorsal blotch (DB) at 1/3 of dorsum in females, linear in males, subtriangular with round corners in females; black spot at 1/3 from base between dorsal blotch and costa; median fascia reduced to a series of pale brown spots, mixed with black scales in costal, central and dorsal portions, extending from just beyond middle of costa to 3/5 of tornus, costal portion broad, central portion extend along outer edge of cell, all scales not raised; subterminal fascia distinct, extending from 1/4 of costa to 1/4 of dorsum, gently convex, with black scales at middle, and costal and dorsal edges; subapical fascia thin, sometimes indistinct, extending from 6/7 of costa to middle of termen, nearly straight; preapical fascia wider than subapical fascia, extending from before apex to 1/3 of termen, nearly straight, costal and dorsal edges with black scales; cilia concolorous with ground colour, gradually becoming longer from apex to distal part of dorsum. Hindwing 4/5 length of forewing, with base to basal 2/3 slightly concave toward distal area of costa, basal 2/3 of costa to apex slightly curved, apex strongly curved and pointed, termen somewhat strongly curved, dorsum strongly curved; ground colour very pale ochre, rather sparsely scaled except along veins; cilia ochrous white, dorsal cilia becoming longer towards base of hindwing.

Venation (Fig. 4): Forewing; with basal fork of 1A+2A to middle, other veins separate, basal 2/5 of CuA2 and basal 3/4 of CuP trace only, M stem clearly present, to between M1 and M2. Hindwing; M3 and CuA1 shortly stalked at base, 1A and 2A with basal fork to 1/4, other veins separate.

Abdomen: Pale brown.

Male genitalia (Fig. 2A–F): Uncus deeply bifurcate into two long, narrow, distally rounded lobes. Socius narrow, posterior part sparsely covered with hairs. Gnathos sclerotised, lateral part broad basally, narrowing towards median part, with five short median spines, apices of median spines pointed. Valva membranous, approximately 3/4 times width of tegumen, sparsely hairy; costa sclerotised, dorsoposterior projection approximately 0.5 times length of valva, with dense strong setae; sacculus sclerotised, saccular projection approximately 0.3 times length of valva, with sparse bristles at edges. Juxta sclerotised, median part with triangular process dorsally, a pair of narrow lobes dorsolaterally. Vinculum long, median part elongated into narrow point. Phallus slightly sclerotised and thin, distal 1/2 and coecum penis somewhat more sclerotised, cornuti tiny thorns.

Female genitalia (Fig. 3A, B): Papilla analis slender and long, inner edge sinuate. Apophysis posterioris approximately 1.2 length of apophysis anterioris. Ductus bursae approximately 2.5 times length of apophysis anterioris, anterior 2/3 twisted, with slightly sclerotized ring near ductus seminalis. Ductus seminalis from posterior 3/4 of ductus bursae. Corpus bursae large and oblong, with a pair of signa, basal round plates with a flattened trigonal cone projection inwardly, longer side acute and shorter side angular.

DNA sequence data

The sequences data of the six examined specimens were deposited in GenBank and BOLD. For more details, see Table 1.

Distribution

Japan (Honshu [Kanto region and southwards], Shikoku, Kyushu, Tsushima Island, Amamiooshima Island, and Okinawajima Island).

Etymology

The specific name fluctuosa refers to the three narrow fasciae in the apical third of the forewing that appear as ripples (Latin: flucticulus).

Remarks

The DNA barcodes of the individual collected from Okinawajima Island were 1.56–2.38% distant from those of individuals collected in Honshu, Kyushu, and Tsushima Island (Table 2). In addition, the forewing length of individuals collected from Okinawajima Island were slightly shorter than those of individuals collected from other regions. However, in the absence of other morphological differences, we provisionally assign the specimen to Homalernis fluctuosa.

Table 2.
Download as
CSV
XLSX

Intraspecific K2P pairwise distances between DNA barcode sequences of Homalernis fluctuosa. GenBank accession numbers are appended to each sample.

PP131391 PP131390 PP131389 PP131388 PP131387
PP131391
PP131390 0.15%
PP131389 0.30% 0.46%
PP131388 0.61% 0.77% 0.30%
PP131387 0.30% 0.46% 0.61% 0.61%
PP131386 1.72% 1.56% 2.05% 2.38% 2.05%

Discussion

Homalernis fluctuosa, sp. nov., is the first species of the genus for which both sexes are known. The other known species of this genus, H. semaphora and H. arystis, were described by Meyrick based only on females, and H. jeriau and H. mankoboi were described by Razowski based only on males. We place H. fluctuosa, sp. nov., in Homalernis based on a comparison of its external characteristics and genitalia with those of H. semaphora, the type-species. The association of males and females of H. fluctuosa, sp. nov., was confirmed by molecular data (i.e., barcodes), which showed a genetic distance of 0.15% between females and males from the same locality (Hiroshima Prefecture, Akioota-Chou) (Table 2). A comparison of the male genitalia among several related schoenotenine genera revealed the following putative synapomorphies of Homalernis: uncus narrow and deeply bifurcated with a short fused basal part; gnathos with five short, pointed spines; and valva membranous and short, with a dorsoposterior projection and saccular projection 0.3–0.5 times the length of the valva. External features and the male genitalia of H. fluctuosa, sp. nov., differ significantly from those of the two species described by Razowski (2012). Hence, the generic and tribal position of those two may need to be re-evaluated. Moreover, their narrow and densely scaled hindwings are not similar to any other schoenotenine; they lack any raised scales on the forewing; and they lack the sparse scaling on the hindwing, with scales concentrated on the wing veins. Their male genitalia have a distinctly petiolate uncus, a broad median gnathos arm, and a valva with only one long ventral spine-shaped process, somewhat reminiscent of Tortricini. Although wing venation may be critical for their correct placement, Razowski (2012) simply states ‘a somewhat simplified venation’. All known Schoenotenini have at least a trace of the forewing M-stem ending between M1 and M2, rather than between M2 and M3 as in all other tortricids that possess an M-stem present.

The discovery of both sexes of a species of Homalernis provides an opportunity to re-examine its relationships to allied genera. In previous studies, relationships of Homalernis have focused on wing venation and female genitalia (Diakonoff 1960; Common 1965). Diakonoff (1960) stated that the wing venation of Homalernis is similar to that of Diactenis, and that the female genitalia are similar to those of Metachorista. However, these morphological characteristics were not described in detail. From our study, the following characteristics were found to agree with Diakonoff’s assessment: in the forewing of Homalernis and Diactenis the M-stem originates from the basal 1/3 of the median cell, whereas in Metachorista the M-stem originates from approximately the middle of the cell; the female genitalia of Homalernis and Metachorista share the round basal plate of their signa, whereas Diactenis lacks a signum. Common (1965) considered Homalernis closely related to Syncratus, based on the twisted ductus bursae and the signa represented by a pair of plates with a blade-like projection in the female genitalia. Common (1965) also stated that Homalernis and Syncratus differ in the length of the basal fork of 1A+2A in the forewing, and that veins Rs and M1 of the hindwing extend nearly parallel and are widely separated at the base in Homalernis, whereas they are stalked in Syncratus.

Based on a comparison of the male genitalia of Homalernis and three genera previously considered closely related to this genus (i. e., Diactenis, Metachorista, and Syncratus), we conclude the following. All four genera share an elongated, tapering tip of the phallus; Homalernis shares a bifurcated uncus with Diactenis; and Homalernis shares elongated dorsoposterior and saccular projections reaching the distal edge of the valva with Metachorista. These morphological features suggest that Homalernis could be close to Diactenis and Metachorista. The very short stalked, apically bifurcate uncus and dorsoposterior and saccular projections, which are elongated far beyond the distal edge of the valva, are considered synapomorphies of Homalernis. A comprehensive phylogenetic analysis of Schoenotenini using DNA data is required to determine the details regarding the phylogeny and evolution of this tribe.

Schoenotenini are widely distributed from India to New Zealand (Horak 1998) and have been recorded in relatively high-altitude areas in the Northern Hemisphere. Several species (e.g. Homalernis semaphora, H. arystis, and Diactenis bidentifera Meyrick, 1928) were described from Assam (India), while D. youngi Razowski, 2000 was described from Taiwan. Komai and Nasu (2011) mentioned that at least one undescribed species is known from the Ryukyu Islands, Japan; however, its details remain unknown. Homalernis (excluding H. jeriau and H. mankoboi) is known only from India (Assam) and Japan, and H. fluctuosa is the most northerly species in the Schoenotenini. It seems likely that Homalernis and other schoenotenine species will be found in the northern Oriental and southern Palaearctic areas.

Acknowledgements

We express our gratitude to Dr A. Saito, Mr T. Ban, Mr S. Taru (CBM), and Mr O. Saito (Chiba Prefecture) for allowing us to examine specimens deposited in the CBM. We also thank Mr A. Tomisawa (Ishikawa Prefecture), Mr A. Miyano (Gifu Prefecture), Mr T. Mano (Aichi Prefecture), Mr S. Tomura (Tokushima Prefectural Museum), Mr Y. Manabe (Kohchi Prefecture), Dr Y. Matsui, Mr H. Arashima, Mr J. H. Park, Mr Y. Uehara (ELKU), Mr K. Sasaki (Fukuoka Prefecture), Mr F. Ishiwata (Kagoshima Prefecture), and Mr M. Kimura (Okinawa Prefecture) for providing us with specimens. We thank Dr Y. Nasu (Osaka Metropolitan University) and Dr F. Komai (Hyogo Prefecture) for their continuous support and advice during the study period. We also appreciate the Center for Advanced Instrumental and Educational Supports, Faculty of Agriculture, Kyushu University for the use of its laboratory for DNA analysis.

The first author thanks Dr S. Kamitani and Dr T. Mita (ELKU) for their guidance and valuable advice and Ms I. Kawashima for providing literature.

We are grateful to the subject editor, Dr Erik J. van Nieukerken (Naturalis Biodiversity Center, Leiden), and reviewers, Dr John W. Brown (National Museum of Natural History, Smithsonian Institution, Washington) and Dr Marianne Horak (The Australian National Insect Collection, CSIRO NRCA, GPO Box 1700) for their reviewed and provided helpful suggestions.

References

  • Common IFB (1958) The genera of the Australian Tortricidae. Proceedings of the 10th International Congress of Entomology 1: 289–295.
  • Common IFB (1965) A revision of the Australian Tortricini, Schoenotenini, and Chlidanotini (Lepidoptera: Tortricidae: Tortricinae). Australian Journal of Zoology 13(4): 613–726. https://doi.org/10.1071/ZO9650613
  • Diakonoff A (1939) The genera of the Indo-Malayan and Papuan Tortricidae. Zoologische Mededelingen 21: 111–240.
  • Diakonoff A (1952) Records and descriptions of microlepidoptera (5). Zoologische Mededelingen 31: 165–178.
  • Diakonoff A (1960) Synopsis of the Schoenotenini with descriptions of new genera and species (Lepidoptera, Tortricidae, Chlidanotinae). Nova Guinea, Zoology 4: 43–81.
  • Dugdale JS (1966) A revision of New Zealand Schoenotenini and Cnephasiini (Lepidoptera : Tortricidae : Tortricinae). New Zealand Journal of Science 9(4): 731–775.
  • Fagua G, Condamine FL, Horak M, Zwick A, Sperling FAH (2017) Diversification shifts in leafroller moths linked to continental colonization and the rise of angiosperms. Cladistics 33: 449–466. https://doi.org/10.1111/cla.12185
  • Folmer O, Black M, Hoeh W (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294–299.
  • Groenen F (2022) New species and additional data of Papuan Schoenotenini (Lepidoptera: Tortricidae, Tortricinae). Suara Serangga Papua (SUGAPA digital) 14(2): 84–112. https://www.sugapa.org/2528-2/
  • Horak M (1998) The Tortricoidea. In: Kristensen NP (Ed.) Handbook of Zoology, Lepidoptera, Moths and Butterflies, Vol 1: Evolution, Systematics, and Biogeography. Walter de Gruyter, Berlin, New York, 199–215. https://doi.org/10.1515/9783110804744.199
  • Komai F, Nasu Y (2011) Tortricoidea. In: Komai F, Yoshiyasu Y, Nasu Y, Saito T (Eds) A guide to the lepidoptera of Japan. Tokai University Press, Kanagawa, 271–293. [in Japanese]
  • Kumar S, Stecher G, Li M, Knyaz C, Tamura K (2018) MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Molecular Biology and Evolution 35(6): 1547–1549. https://doi.org/10.1093/molbev/msy096
  • Meyrick E (1918) Exotic Microlepidoptera Vol. 2. Marlborough, Wilts, 640 pp.
  • Razowski J (2008) Tortricidae of the Palaearctic Region. Vol. 1, Tortricini and General Part. Franšek Slamka, Bratislava, 152 pp.
  • Razowski J (2009) Diagnoses and remarks on the genera of Tortricidae (Lepidoptera). Part1. Phricanthini, Tortricini, and Schoenotenini. Polskie pismo entomologiczne 78: 59–90.
login to comment